EST 28968 is a singleton


Sequence

>28968 (1 EST) Length=317 TTTCTTTTTCATCAAAAAACATTGTATGATATACATCTTTTTTAGGTAAACTTTCATTATAAAATTCACTAATTGTAGTA TTACATTCAAATGATTTCTCAATACTTTTTTCGAAATCCAAATCCGATATATCTGCTAAAACAAAAGGGTTTATGTAATT TTCTACTTTATTATTTATTTCATCCTGTTCTGATACAACTTCATTATTCATTTTAGAAATTTACTAAACTNNATATAACT ATTGANTTTAAAAAAAGCAACTAATACNTGTAAAANTATTATTTTATTCATGAAAATTGCTTTNTCTAGGAAACTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28968: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28968319704T098720438m3gmbPfHB3.1, G. Roman Reddy


Date: 18:0:39 on Fri 17 Nov 117.