EST 28969 is a singleton


Sequence

>28969 (1 EST) Length=288 CTTATATATATATATATATTATTATATTTGACAAAACATACACAGATAAAAAAAAATATATTGAACATATTTCAATTTTT TTTTTTTTTTTTTTAAATAATCATAATTAGGTATATAAAAAGAGAAATTAATATTTTTGACAGGATTGTAAAAAGGTTAT GTTGTAATATTATATAATATCATATAATACATTTTTATAATNNATAAAGNTGATACATATATATATTTGNTAAANCNCNA TAGCTAAAAAATGTGATGTGTATGGNAAAATCCAACACCATAAANAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28969: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28969319705T098730439m3gmbPfHB3.1, G. Roman Reddy


Date: 16:46:39 on Wed 22 Nov 117.