EST 28970 is a singleton


Sequence

>28970 (1 EST) Length=321 TATTTGTATAATATCTTTTTATTTACCTATTCGTATTTAAAATGTATCATAATTAAATAAAGAAAAAAGTATATATATTA TATGTAGGTTTATCCTATATACATATTATAGGAAAAACTTTAGCGTAAAATTTTATTTTATTTTATTTTATTTTACTTTA TTTTTTTTATTTTTTATTTTTTTTTTTTTTGTATAAAATATAATGGGGAAAAATAAAAAAAGNAAAAATTCAAGAGATAT AAATCCATGTGATAATAATATTGGNGTTAATAAGGCAAAAGNTAACGTTATTAATTATAATGNTATTGATAAACNTTTAC A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28970: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28970319706T098740439m7gmbPfHB3.1, G. Roman Reddy


Date: 6:13:56 on Wed 22 Nov 117.