EST 28997 is a singleton


Sequence

>28997 (1 EST) Length=244 TTTNTTATTTGTCATTTTTCTTAATTAGTATTATTAATAGTTTATCCAATTTTTTGGAAAAATTGCATTAGGCTACTTGA TCTAGTGGTATGATTCTTGCTTCGGGTGCAAGACGTCCCGGGTTCGATTCCCGGAGTAGCCCAAAAAAAAAAAAAAATAA ATAATAATAAANTAAAGCAAATGGTAATAATATTGTTATAACATGAATAAGNGATTATATAGTATATAAATATATAATAT AATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28997: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28997319733T099010453m7gmbPfHB3.1, G. Roman Reddy


Date: 11:50:59 on Fri 24 Nov 117.