EST 29002 is a singleton


Sequence

>29002 (1 EST) Length=309 TTATTATTACTATTATTATCAACATTTNCAGTATCACATATATTAAGATCCTCTTTTTCAATATCATTAAATTTAATCTT ATTATCACAATCAAGTTTTCTCTTATCATTCACATCTTCCATGATGCCATTTTCTATACGATCATCCTTATTCATTTTTT TNTTTNTTTTTTTATTCAATTCTTCATTATCATCATACATATGCATCTNCTTATTTTTTAACAAACATTTCCCTCTAATT CTCGATCGTGTCGTCCCTAATCTAACACCGTGTGATATAAAGTTGCTTGTGCTAATATATCCTTTCTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29002: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29002319738T099060458m3gmbPfHB3.1, G. Roman Reddy


Date: 19:58:2 on Sat 18 Nov 117.