EST 29007 is a singleton


Sequence

>29007 (1 EST) Length=340 AAAATATTATTATTTTAATATATGTTACATAAATATATACATATATATATAAGAAAATGTTATTGTCTTGATTTCATTCC AAGAATTATAATCAAAATAAAATAAAATCTAATCAAATCTAATCAAATCAAGTCTATACAGANTTCACTTTATAAGTGAA AAACAATAAACAATTTATATATCCTTTTATGATTAATTTATTATATTTTTNTNTGTTNTTTAACGGCTCGTTAATATGGA AAGNTAAAAAAATATTATATAATAAAAATNTGCACATATCTATCAATATCAATATTAATNTGTATATATGNATATATTTN TTCATNTATTTTTTGGGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 29007: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29007319743T099110461m3gmbPfHB3.1, G. Roman Reddy


Date: 4:34:38 on Mon 20 Nov 117.