EST 29008 is a singleton


Sequence

>29008 (1 EST) Length=337 TGTTTATTATTTATTGTTCATTATTTATTATTTATTGTTCATTATTTATTGTTCATTATTTATTGTTCATTATTTATTGT CTATTGTTTATTATTTATTATTATTTATTGTTTTTTNNCCNTTTTTTTTCCNTAGATGGCATTTATTCCGACAGACATTA GATGTTCCTNGTGGATAATTTTAAAAGAGTATCATTTCAGAAGCTTATCTAAGAAAAAAAAAAAGAAAAAGNAAGGTACC AATTATNATTTTAATTCAAAGTTGGNAAAGGTTGAAAAGNTTAAATGNTTTAAAGANTTTTTTTAAAATGTGTGTAATTA CTTATATTCCCTTTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 29008: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29008319744T099120461m7gmbPfHB3.1, G. Roman Reddy


Date: 2:43:27 on Sat 25 Nov 117.