EST 2901 is in sequence CPlasFal_1166


Sequence

>CPlasFal_1166 (2 EST) Length=423 TAACCATCTGGNTTGTTTTGTTTTGTTTTGTTTTATTTTTTCTTACTTGTGTTCTGCTACGAACTCTTATGCTACCAGAC AATTTTCCGTCGGCACTTTTCTGAACAGACAGGTTAGCTAGCGAATCTTCTACAAATATACTTCTTGAAAACAAATTAAC CGAGAAAAATGCCGAATTATTAACTAAGCATTTTAAATCTTCCAAGGTCGAAATATAAGAAATGTATATATCTATAGGGC TTATGTTTACTTGGTTTACGTTATTTTTTATTTCCATATCGTAATATTCAAGAGGCATAAATCTCTCAACAAATCGTCAT ATTGGTATTTTTTATAATTAAGTTTGAGTAATTCAAATGCATCCCTACAAAACACAACAAAATAAAACAAAATAAAACAA AATAAAACAAAATAAAAAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_1166: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29018319754T099220470m3gmbPfHB3.1, G. Roman Reddy
29019319755T099230470m7gmbPfHB3.1, G. Roman Reddy


Date: 2:31:14 on Mon 20 Nov 117.