EST 29013 is a singleton


Sequence

>29013 (1 EST) Length=376 CCTATTAAATACATATAACAATACATATAACTTATTATTCCATTTCTCATTAATTTTTTGTTAAATTTTTGCATTGTCGN CCTTTTTCATACTTTCTTTTTTCTCCAATTTTTCTTGAATAGTTTTTTCTTTCTTTTTTATTTTTTCTTCTTTTTTCAAA TTATCTNNATCCATTTTTTTTTGTTTCTTGGCCTCTTCTATTCTTTGGGACATAGCGTTTAATTTCCNCTGTCTTATATC ATATATTTNGGNTAGTAGNTCTTCATNCTNGAATAATTTTACACCTNCTTCGGAAGCCATCCATTTCTAAAAAGGNATAA AAAAATATAAAAATAAAAAATAGGGGNATGGGGTATGGGNTATAATAAAGNANAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29013: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29013319749T099170466m3gmbPfHB3.1, G. Roman Reddy


Date: 19:18:58 on Wed 22 Nov 117.