EST 29014 is a singleton


Sequence

>29014 (1 EST) Length=300 TTTATTTTTNTTATTATTTTTTTTTTCTCAGCATTCTCATGGTAAAATGACCAAAAAGGATATCCTTCTGGAGCAGTTCA AACAAAAGTAAAAATAAATACCAAAATTATTATGTCTTATATATACATTTATGTAATGATAATTATTATTCTTTTATTTT TCTATTCAACTTAGAAATGAGCACTTAACAAAAGCTGACACGGAAAGNAAGTTCAAAATGTATTTGGTATACAAAAAGTG TGAAGACAACAGNAAGGTAAAAAGNTATACATATNTATATCTATATATATATGTGCCTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 29014: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29014319750T099180466m7gmbPfHB3.1, G. Roman Reddy


Date: 16:30:40 on Mon 20 Nov 117.