EST 29022 is a singleton


Sequence

>29022 (1 EST) Length=216 TATTTTATATATATAACAANTTAAANTATATTTACATATATATGTGTGTTTTATTTNTCTAAATTATAATTTTCANTTTT CTCCCATGTCTCATTTAATTTTTCGCAAAGGAGAAAAATTTACTCATGTATATTATTTTTAGATACATATAAATTTGCCC TTTTAAGCAANANTATTCATTATTATTAACATACACACGTGTTATATACACACATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 29022: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29022319758T099260472m7gmbPfHB3.1, G. Roman Reddy


Date: 4:55:8 on Sat 18 Nov 117.