EST 29023 is a singleton


Sequence

>29023 (1 EST) Length=319 TATTATAAGATTAAGAATATTTCATAATACTTTACAAACTTATATGTGCATCATTTTTTTGGTTTTTATTTATTATTATT ATTTTNTTTTTAGTTTTATATTTTTAAAAAATATAATGTATAGAAAATTTAATTACATGTTATGGATGTTCTATATATTT CTTTTTAAAATTGCTCTTGTTTACTAATGTATGATTCTNCTTTTTTTTTTTTTTTTTTNCNNTTTTAATCATATTTTTAT TAGGAATGAAAGAAATAAAAAGAAGGCTATATTTTCAAATGATGATTTTACAGGNGANGCTAGTTTAATGGAGGNAAGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29023: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29023319759T099270473m3gmbPfHB3.1, G. Roman Reddy


Date: 2:36:24 on Wed 22 Nov 117.