EST 29035 is a singleton


Sequence

>29035 (1 EST) Length=399 AAAAAAAAAAAAAAAGGAAAGAAGTAAAATAATACAAAATGTACAAAATGTACAAAATGTACAAAATGTACAAAATGTAC AAAATATACAAAATGTACAAAATGTACAAAATGTACAAAATATACAAAATGTACAAAATGTACAAAATGTACAAAATATA CAAAATGTGTGTAAAGTAAAAANTTTTGAATCTATCATTAGATGATTTATGTGTAGGNTCCTTTATTTCATAAGGTTATA ATAGANTATATTATATGTNCATCTATTCATACGTTTATATGCTCAGATTCTTTTATATAATTCNTTGATTTATTATTATT TCCTTTTTGNNTTTTTTGTGTGTGTGTGTAGGGTCCCTATTATTCCCAGGGTATGGCCACCAATTTGCATGGCTGCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29035: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29035319771T099390488m7gmbPfHB3.1, G. Roman Reddy


Date: 20:49:8 on Sun 19 Nov 117.