EST 29036 is a singleton


Sequence

>29036 (1 EST) Length=263 CCATACATTTATATAAAAAAAAGAAAAAAAGAGAGAATAGAAAGTTCAAAATAAAATTCAATAGAAAGTTCAAAATAAAA TTCAATAGAAAATTCAATAGAATATTCAAAATAAAACTCCATAGNATATTCAAAATAAAACTCAATAGAATATGCAAAAG TAAAATCAATTGAAAAAAGTAACATGAAAATTCTAAAGAAAATACAAATGAATATAGCAATATAAATTACCTATTCATTT TCATGATTTANAAAAAAAAAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29036: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29036319772T099400490m3gmbPfHB3.1, G. Roman Reddy


Date: 20:44:26 on Sun 19 Nov 117.