EST 2904 is in sequence 29042


Sequence

>29042 (1 EST) Length=389 GTTTGAATGCTTTTTCGTATAGTAATCTAAAAAAAATAAATACTTAAAAAAATAGGTGCCAAAAGAAAATACTTATTGTG TTTTTTTTTTATTATTATTATTTTTTTTATTATTATTTTTTTTTTTTATGTTCGTGTTATTATTACCTTGCAGCAATCCC TTGGAAACCAAAAAATTTAAACAAACAAAAGGNTCATCTAGCTGGTCTACATCCTTTTCATTTTTAAAATTATACACCTT GANTAAAAATTCTTTCATTAAATCTTGTTCATATAATTTCCAACTATATTGTAATAATTTTATTTTTNTTATAAAATCAA ATATCTCCTGGACGGGGTAAGGGATTTTANTTCTNTTAATTGCTNTTTGGNCTATTCCATAATAAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 29042: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29042319778T099460494m3gmbPfHB3.1, G. Roman Reddy


Date: 11:11:7 on Sun 19 Nov 117.