EST 29052 is a singleton


Sequence

>29052 (1 EST) Length=378 TGCTTGTGCATATATTTGTGAGTGTATAAACAGTGTTTCCAAAAATGTCGGATNTTTTTACATCTAATATTCAAGTATAT TATTTAGTGTATTCATTACAGTTCACTACCTCTATATTTTGATCCGTTCAGAGACAAGAGAAATCTTTGTGAATAGATGA TGAAGAAATGGAATTCCTGAAAAAATGCTGGGATTATATATTAAGAATGGGAGAATTATTATTGGATCGACTCAATGTTT AATTCATCTATATATATATATTATATGANTTTATGTNATTTNGTATTANTTATTATAANTCNTTCCTAATTATTTAATGN TGTGCTTATTAATAATATATATTAGTCCTACTTGAAGGNTCCATAATTATTGGNCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 29052: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29052319788T099560505m3gmbPfHB3.1, G. Roman Reddy


Date: 11:24:5 on Sun 19 Nov 117.