EST 29054 is a singleton


Sequence

>29054 (1 EST) Length=177 TTTTAAGTGACAATATTTTAAGTAATAATATTTTATGTGACAATATTGTTAATGACAAGATTAAGTATGATAAAGGGGAA AAGTGGNTAAATGAAAATGTGTTGAAAAAAGTGGAAGGAAAAGATAATGAGAATTTGGATGATTTTNATGATAAGGATAA GAGGAATAATAATANNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 29054: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29054319790T099580507m3gmbPfHB3.1, G. Roman Reddy


Date: 15:1:46 on Thu 23 Nov 117.