EST 29056 is a singleton


Sequence

>29056 (1 EST) Length=295 AAAAAAGAAAGAACGAAAAGAAAAGGATTTCCAGAAAAACCTATATTATATATTAAAAGTAAATAGAAAAAAAAAAGATG TGCAGAAAAATAAAAAAGAAAATAATTCAGACAATGTCAAATCAAGTACACAAAATAAAAAAAAAAAACATTTCTCATCT AATAGTTCAGANGATTCTGAGACGTTTTCACATTCGGATGTTAGCTATCAATGTTCTTCTCCTGACGNNTTAGCTTTCTT AAAATATGCAACTAATTGTGGTTTTATATTGAAAANGGAAACTGCTAGTAAANTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29056: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29056319792T099600521m7gmbPfHB3.1, G. Roman Reddy


Date: 16:18:16 on Fri 17 Nov 117.