EST 29060 is a singleton


Sequence

>29060 (1 EST) Length=238 GAAAAATGGAAAGCCATTCAAATACGGTCACCTACGTTGTGCATAGCTCGACCGTTTATTTATCTTTCTATTTAATTATA AAAATAATTGTTTTTATTTTTNCTTATGTACTGGAAAATAAATTTTGTAAACTGGGTTTGAATAAAATTTATAATAAGGT AAAGAAGATTTATTATAGATATATGGAAAGTTCAGAATATAGTAAAATAAATGATAACATAGNAATAATAGAAAANNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 29060: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29060319796T099640525m7gmbPfHB3.1, G. Roman Reddy


Date: 12:32:8 on Sun 19 Nov 117.