EST 29063 is a singleton


Sequence

>29063 (1 EST) Length=400 GGATAAGAAGAAAAAGGCTTCAGCAGAAGAATTATATATAGAGAAAACTAAAGAAATGACAACATTAAAAACAAAATCAA ATTTTATTACAGGTTTGATTTTTATGTGTGTTATGCCAGTATTATTTAGTTTATTTGAAGGATTAACCATTGCTGTATTA CCATTTAAACCAATCTTTCCATTTACCTTATTAACACGTACAGGTCTACAATCAAAAAATGTTTATCATTGCTCATCAAC TTTTATATATACCTTAACACTTATGTTAACAAGGCAAAATATTCAAAAATATTTNGGATATGCTCCCCCAGCAGGAATGT TTGGNGATTATAAAATGCCAGGTGGACAAGCTGNCGGATGGNAATGAGCATATATATNTATATATNGGGCNTTANTATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29063: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29063319799T099670529m7gmbPfHB3.1, G. Roman Reddy


Date: 22:59:32 on Fri 24 Nov 117.