EST 29065 is a singleton


Sequence

>29065 (1 EST) Length=196 GTATTTTTTTTTTTTTTTTTTTTTTGCAAGTTTTTGAAATGAAGATAAGGTCTAGTGCTAAGCTTATATATTCCTTAAAA AAAAAGTAATTTTTTTTTCTTAATGCATAAAACTATGTACGAAATAATATAATTTATTGTAATTATATTAATGGCTAAAA TTAATAATTGTTTTTATATTGGATATATATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29065: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29065319801T099690530m7gmbPfHB3.1, G. Roman Reddy


Date: 11:54:2 on Fri 24 Nov 117.