EST 29067 is a singleton


Sequence

>29067 (1 EST) Length=336 GAATTGGGTACGGGCCCCCCCTCGAGGTCGACGGTATCGNTAAGCTTGATCCTTTACTTAAATTATAAAACAGAATACAT ATACACACATACAAAAAAGTGCATACATAATTACAAACATAAATACATACATAAACACATGACACTAAAATTTTTATAAT TTATTATATTTTTTAATTTGTGGNAACTTTCATTTTAATTTTTTTTTTTTCNNTTTTTTTTTAAACATACACATATATTT NTTAGATTTCATAATTTTTTTAATTAATACTATAAAANATTGANGNTATATGTGTGTTCGTGNCTTAAACAAATTCACAT AAATATTTATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29067: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29067319803T099710531m7gmbPfHB3.1, G. Roman Reddy


Date: 15:18:3 on Thu 23 Nov 117.