EST 2908 is in sequence 29089


Sequence

>29089 (1 EST) Length=399 TGTTATTATGTGTATCTTGTATTCTTTCTTCATTATATATATTATAATTTNCTCCTGTATCTTTATAATTACAAATATTA CATAATAAAAATAAAAGACGTAGAAATTTTTTATGACATGTAAAATTTGGTAACACTATATACTTGTTTATTATTATAGT ATCTATGAAAAAATAAGATTTCAATAATAAATATAANCAAAAAAAATCAAGATAATATTTATNTNTNATTAATATATAAC ANCAATATATCATGCATGTATATAATTNACTCATAANATATAATNCCTCTNTCTCATAATCCTTTGGATATTTACATACA TCCAAAAAAAAATCTNTTACAATATTGTGGGGACTCATGTNATCACCATTTGNGGCNTTNCCTTTTCTCTTAAATAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 29089: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29089319825T099930547m3gmbPfHB3.1, G. Roman Reddy


Date: 12:2:35 on Fri 24 Nov 117.