EST 29080 is a singleton


Sequence

>29080 (1 EST) Length=330 TTATTTATTTATATTTTTTATATCGTTTAATTTTTTTTTTTTTTTTTTTTTTTTCCACATTTCTCTTTTTATTTTATTTT ATTTTATTTTATTTATAATTTTTTTCAAGTATGAAAAATTACAAAGGNGAAGATTCAAATGACAATGTTCCCAAGGTTTC AAATTCTGCTGCTTCTCCATCTCCTTCTCCTTCTATACCTTTTAATAACAACCGAGGAAGTAAAATAGGGAACTCCACAT ATAATCAGAACTTTCTAAATAATAATNCCNCATATAATAAACAGCCAAATAATTTNGGGGCATCAAATTATCCTNATATA ACTAAAAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29080: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29080319816T099840540m7gmbPfHB3.1, G. Roman Reddy


Date: 16:23:54 on Fri 17 Nov 117.