EST 29084 is a singleton


Sequence

>29084 (1 EST) Length=198 TGAAGAACATAAGCTTGTTATTTTTTTTTTTGGGTTTTCTTACTAATACTCTCTTGTTATATAAGTTTCTATTGTTGATA AATATTCGAGCTGCTTCTGGATTAGCAGGGGAAGNTGTATTGGGGTCATTTAACAAAGACTGAATTGATGTTAGTATAGA TGTAATATCATATATAGGACTCCATTGGTTTTGTNNAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29084: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29084319820T099880543m7gmbPfHB3.1, G. Roman Reddy


Date: 22:55:24 on Wed 22 Nov 117.