EST 29085 is a singleton


Sequence

>29085 (1 EST) Length=270 AGATAATATAAATATACAACAAATATATACAGCTGATACTATCATTTCATTATTTCTATCAAATAANTNCCCAAGNCATA TATTCTACGGTCAAAATGCACTAATATCATTTAATCATTTTAGATGGCCTCTACTAGTAGATATACAAAATATTGGCTTA CAATGGTTAAAAAAAAGTTTTACTAATAATCTAGTAATACATAACTTTGATGATANTATAACCANACATCTAGACATGTG TATAATATATGGCAAAATACTTNTCATACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 29085: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29085319821T099890545m3gmbPfHB3.1, G. Roman Reddy


Date: 10:32:46 on Mon 20 Nov 117.