EST 29088 is a singleton


Sequence

>29088 (1 EST) Length=122 ATATACACACATAAAATATATGAAGNCACACATAACATCATATTTTTTTAAAAATGAAACGTTAATATATTTAGCTATAT ATAAAATAAATAATACAAAATAATAATATTAANNNTTGNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 29088: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
29088319824T099920546m7gmbPfHB3.1, G. Roman Reddy


Date: 4:26:47 on Wed 22 Nov 117.