EST 291542 is a singleton


Sequence

>291542 (1 EST) Length=344 CTGGCTTGAACTTCTTAGCTTACTTCTTCTGGCTTCAGCCACATCACAGTTCAGTTCTGGCCCATTACAACAGTCGCAGC CACGTGGATTAGATACCGAACAATGTCAAACGAATAGTCCCGGTGATTGTAATCCATACTCATGCCGNGGTACCTGTGAA GGACGATATGTTCGNNNNGGGGATAGCAGACTAAAAATTGATCGAACTGTGANAAGTTGTCAATGCATGCAGGAGCCANT ATGTAGTTTANTTGGAATGAATGNATATACCGGTTGTCGAACTTATACTATGCTATCAACATCAGCACAACGATTCATCC GATTATGGACAATGAATGATGCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 291542: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291542902074H30918SW3ICA131SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 18:26:4 on Fri 17 Nov 117.