EST 291551 is a singleton


Sequence

>291551 (1 EST) Length=348 GTTATTTCGTACATATGCCGAAATATACAGAATATTATGATGGAGAAGTGTNCAGTACGTGTACCGTTAGCTCAAAATAT AATAGTTTTACGGGAATGCGATACGCTGCATATTGGAAATTGCTTCTGCGAGATATATTTATGCCTCGAGGCTATCCACA GAGTGTNTCTCCAGATTATATGAACTATCAAATGTGGGATACTATTCAAGCTGNNGGTAGTTCTATGAGTTCAGCGTTGT CTACCGAAGCAATATTGCGGGGTGTAGGCGTAGGAAATAAGCAGACATATAAATGAGAACTAGTACGAATGANGGAATGG NGATGGTATTAAGTAATGGTGGCTACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 291551: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291551902083H30927SW3ICA147SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:32:34 on Thu 23 Nov 117.