EST 291554 is a singleton


Sequence

>291554 (1 EST) Length=346 TTTCTGCCAGATTTGCCATTCTATTGTCAGTCATTGTTGGGTCACCACTACTATGTTCCCAACTTTCGTTTTCTTGTTTT TCTTCCGTAATTTCTTCCTCATCACTTTCATTCATTTCATCATCTTCATCTTCCTCTTCATAATCGGCTTCATTGTATCC AGGTACTTGGAAATATAACCCAGAGTTCTCTTTTCTCCTGACCATATAACCATGTTCTGGGNATAATGCGTTCATTAACT GAAATGATGAATTCGNAGNACAAGAATTTCAAGCTATTCCGTGTTGCCCTTAGTTATTTGGAAACTGTTGATCTACTAGT GCATAATATTGTCACCTGAAGCTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 291554: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291554902086H30930SW3ICA153SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 12:42:39 on Sun 19 Nov 117.