EST 291573 is a singleton


Sequence

>291573 (1 EST) Length=401 TTNGAGGGCGTAGTACTAAAAAGGAGGGACGATATGGAGAACGCCCACACGAAATCAACCGATGAGGTCTTACAGTATTT CGGTGTCAGTGGTGATGTTGGCCTTACCGAGAAACAGGTTCTTCAAAACAGAGAAAAATATGGCTCCAATGAACTGCCAG CTGAAGAAGGGAAGAAATTATGGGAATTAATATTGGAACAGTTCGACGATCTCCTTGTCAAAATTTNGCTTCTTGCTGCT ATCATTTCATTCGTGCTAGCCTTATTTGAAGAACACGACGATCAAACATCAGCGGTCACTGCATTCGTTGAACCTTTTGT AATTTTGCTTATCTTAATAGCAAATGCAACGGTCGGTGTTTGGCAAGAGAGGAATGCCGAAAGTGCTATAGAAGCTCTTA A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 291573: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291573902105H30949SW3ICA170SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 4:14:5 on Thu 23 Nov 117.