EST 291590 is a singleton


Sequence

>291590 (1 EST) Length=274 TGGAGAGAAGAAGCGATATCATGGAAACNGCTACCAANTCCGGACNGCACGTCTATCGCATGGTGCNCCATTTCCAGANA TATGCTAAAAAGTGCATCGAACTCGGTNTTCCAGCACCATCTGCAGCAGAATTGACGAGAAATGCATCACAAGCATTGAC AGATTCGGGATTCGAAGATAAGAAGANACTGCGTCATTGCTNNCGATGTAATTTGGGNTTTGACTTCTACANAGGACTGC TCNCAANCAAGATTGGCCAAGTGCATAAAAGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 291590: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291590902122H30966SW3ICA215SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:16:19 on Sat 18 Nov 117.