EST 291621 is a singleton


Sequence

>291621 (1 EST) Length=172 TCACAGTCTGTGGATAGCAAGCTTTTATTTCACAATACATCATGGATGAAAATCAATTCAACGATAGGTGCCGGTTGTGC CTTGATTCAGACAGTTCATCACCGNTATCATCTATGGACGACGAAGCCTNTCGNACTATGTTGGATGCCGGTTGTNACTT TGTGTTCGNNAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 291621: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291621902153H30997SW3ICA263SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 4:42:50 on Wed 22 Nov 117.