EST 291632 is a singleton


Sequence

>291632 (1 EST) Length=327 CAGATTTCGCAATGAGCTGCTGGTCCGCGATTTCAAGAAAAAATTGAAGAGACTTCATCACTCCTCATTTGGTGGTGCTT CGTAATAATATTTCCCAGACTTGTTTGGTCTATCATCCTCTAATTTCTTGAAAGTCAGGATTGTTTGGGTTATAGTGATA TTGTCTTTTTCCTTATTTGGTCATTCACAGATACCTGGTCATGTTCAAAAAAACTCATGTTTCATTATGGTGTTATAAGT GACTGATCGTCATTACTTGTTTATCTTTATCAGATTTCATTTTATTGTTTAGTTTATAGGTCAATGTCAAGTCCTTTTCC GTGACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 291632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291632902164H31008SW3ICA275SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 16:55:32 on Wed 22 Nov 117.