EST 2919 is a singleton


Sequence

>2919 (1 EST) Length=256 TAAAGCTGACTATGCGGTTAGGAATAGAAGGAAAATGCTTCATCATGTGGATATATACATTTGATAATAATTTATATAGA GATGTAAAGTTATATATATATATATGTATNTTTTTTTTTTTTTTTTTTTTTTGAAGAGATTGGATGAAAATNATGAGCCT CCCATATAAATAAGTTATCAATCGAATCTCCTAAGGCATAATTATCCCAAGTATATTTNNCTAGGANTGGCAAAATTAAT TGNCCANTNTATATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2919: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2919319255T027370083M7gmbPfHB3.1, G. Roman Reddy


Date: 21:23:17 on Fri 24 Nov 117.