EST 2920 is a singleton


Sequence

>2920 (1 EST) Length=231 CATATATTATTTATTCCATACAGGTAATTTTGGTCATATTAGATAACACTTATATAATGGAAACCTCTTCCAAATTTTTC GACAATGATAATGTAACTGGGTACATAATATTTGTTTTAAGAATATCACTAGCTATTTAATATCATTTTAATATAAACAA TTTATTTACAATGTCTAAGATTACACCAATTCGTAAATTTTTAAAAAAATTGTATGTATACGGNCTATTTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2920: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2920319256T027380084M3gmbPfHB3.1, G. Roman Reddy


Date: 2:0:16 on Wed 22 Nov 117.