EST 2921 is a singleton


Sequence

>2921 (1 EST) Length=208 ATATTTTTAAGCTTGTTCGTGAATATTGGTATTTCACGTGATATCTAGTGATTAGGCATTTAAAAAGCACAATAATANAT ATGTATAATATATATATATATNGNGGNGTATATTTAATTTGAAAAAAAAAAGANAAAGAAAAGATAATCTAAATAATTAT AAAACNTATATATATTTCCNTTTANTTTTTAATTTTCCTTAATNTTTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2921: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2921319257T027390084M7gmbPfHB3.1, G. Roman Reddy


Date: 19:41:4 on Fri 17 Nov 117.