EST 2923 is a singleton


Sequence

>2923 (1 EST) Length=322 CATATATATATTATGTATATACCTCTTTGGTAATCATTTTATTTTTATTAGTATCAACATCTGCAGTAGGTTTATCCTCG TGATCATTCACATTATCATTATTCTCTTGTCCTTTTTTNATTTTTAATTCTTCATTTCTTTCCTNATTTCCTTCTTCGAG AAGATTCGTCAATACTCTATTGACAATGTCATTAATTCCTTTTTTCCTTTTATATAAATCATTTCCTTTCAAATTAAAAA TTNCTNCAAGTTTTTGTCTAACATGTCTTCGGCTTATTTGTGCAGCGGTTTCAATGGGCACAAACGNTCTGNAAAAAANA AA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2923: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2923319259T027410085M7gmbPfHB3.1, G. Roman Reddy


Date: 19:11:2 on Sun 19 Nov 117.