EST 2924 is a singleton


Sequence

>2924 (1 EST) Length=360 AATATTTATATTATATATTTAATATAAAAGAACTATATCTTTTNCTTGAAATAAATAACATGCCTAAAGAAATACATTTA AGAACAAATACATTAAAAATAACAAGNAATAATCTTATGAAAATTTTGAAAAATCAAAATGTGTCGGTACAAGACGGAGA ATCATGGAATCATGTAGGAATAACTATAAAAGATGTTAATACTAATGTAGGTTCATTAAATGANTATCTTTATGGTTATT ATATTATNCAATCATCTTCATCTCTTATGCCAGTCCTTGANTTAAATATACAAGGNGATGNTATGGTCTTAGGTATGTGT GCAGCACCTGGNGGGNAAATGGACCTNCATGTGTNCCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2924: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2924319260T027420086M7gmbPfHB3.1, G. Roman Reddy


Date: 6:59:26 on Tue 21 Nov 117.