EST 2932 is a singleton


Sequence

>2932 (1 EST) Length=202 ATTAATTNATTTTGTTTACCATATGGATGAGAAAAAAAAAGACTTTTACAATTATGTGGATCGTATGCATAAAAAGAATG AAGAAGTACACAAACTTATTGAGATTAATGAAAAGGTAAAAAATGGTGAAATAAAAAACTTAGAAGANTGGGAAANGGTT CGAAAAAATAATGATATATGTNTAACTCCATTAGATAATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2932: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2932319268T027500090M7gmbPfHB3.1, G. Roman Reddy


Date: 23:30:49 on Fri 17 Nov 117.