EST 2933 is a singleton


Sequence

>2933 (1 EST) Length=285 TATATATATATTGTCAAATATATATATTTTTAAATTATAAATTCAGAAAAAAAAATGAATTATTGTAAAACCACGTTCCA TATATTTTTTTTTGTCTTGTTCTTTANAACCATTTATGAAATAAAATGTCAACTACGCTTTGCGTCTTTGGGTGATTGGG GTAAGGNTACAAAAGGTCAGATATTGAATGCAAAGTATTTTAAACAATTTATAAAGAATGNAAGAGTTACATTTATCGTT AGTCCTGGTTCTAATTTCATTGATGGNGTTAAAGGGCTTAANTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2933: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2933319269T027510092M3gmbPfHB3.1, G. Roman Reddy


Date: 20:58:21 on Wed 22 Nov 117.