EST 2943 is a singleton


Sequence

>2943 (1 EST) Length=386 TCTTTTTATTTTTTTATTTTATTATTTTTTCCTTCAAATGCTTATAAGATTTTACTCTTTTCTCTGTTAAGCCTTCTTAA GTCCCTTTCACGTATCGAATTTCTAACCTCATTCAAAGACGAGTCGATTGTTTTNCTTTTCTTAAAATTTGCGTTGTCAT TTTTTTTGGCTGAAGAATTCATATCTGTNACAATAGCATTTACACAATTGAGAGCTTCATTTTCCGTTTTTAAATTATTG AAAATATCATAATCATCATATAAACATATATCCTNCATATTATTCATTTTGATATAATACAAATNATTTTTAAATATATN ATTTCCNTTTAGTTTTTCCCATATGGATGATGATTATCNATCGGGGATTATGAATTTNGTCATCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2943: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2943319279T027610099M7gmbPfHB3.1, G. Roman Reddy


Date: 19:21:38 on Fri 24 Nov 117.