EST 2946 is a singleton


Sequence

>2946 (1 EST) Length=225 AATTCTNCTTTCAAGTCGATAGAAAGTAATCTTGATCTTCAAAGAAGCATATTACAATCTGGGGACACACAACAAGTAGT TGTAATTAATAAATCGAAAAATGTAAATGTCCTTTTNCCAGATAAAAAAAAAAATCACACACACCCAAATGAAGAGAAGA GANCATTTCCTAAATATATCTCTTTAGTATATAANGAAAAAAATAAGGNCAATGAAAAANTAGNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2946: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2946319280T027640101M3gmbPfHB3.1, G. Roman Reddy


Date: 21:58:7 on Sat 18 Nov 117.