EST 2957 is a singleton


Sequence

>2957 (1 EST) Length=419 GATTTTGTCTGATTCTTCCCATCGTTTGTATTAACACAACTATGTGATACTAGCTTATACAACTTTCCTCTCTTGAAACG ATTAAGAACACCTTGAAGTGATTCTCTTGTCTGAACAGGTATGTATGGNTCACATAAAAAAATATAATTNGACATTAATC TTGCGATAACTAAATTTNGATATTCTTTAAAATGTTGTAATAATTTCAGATGAAATNCTTCTCCTTTATGTNCATAATCT AATGGTTGTAACTCTAAAGGAACTTCTCTTTNAACTGTTTTAAGTTGATTCTGNTTNCTNCTAATATGTGATGTGTTTAA NTATTGNTAACGGAAATCTCCTATATGGGGCTATCCACTTTCCCAATTANATATCNCCNGGGGGAACAANCGGGAANCNT TAACCCNGGCCCCTTAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2957319291T027750118M3gmbPfHB3.1, G. Roman Reddy


Date: 0:23:10 on Fri 24 Nov 117.