EST 2958 is a singleton


Sequence

>2958 (1 EST) Length=245 TATTTATTTCATATATTTNAGCATGAAAAACTTTTATGATAACCAAATGAAAATGTTACAAGANCTGGGTGGTGAGAAGG AAGGGAATTTAAAAGAAGGTGAAGAAGAAAAAATATTTGAAGATGCACTAAAGAATTGCAAAGAATCAGAGGAAATTNCT AAAANGTTATTAGTAGATGGTGCGAAANCCTTGTGGATAANTTTTCATAACCCTAATGTATCAAATGTTGATAATAATGN NTGGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2958: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2958319292T027760118M7gmbPfHB3.1, G. Roman Reddy


Date: 8:22:54 on Fri 24 Nov 117.