EST 2959 is a singleton


Sequence

>2959 (1 EST) Length=386 GATATTTTATGTTTTATTTGTTCTTTTATGAGTATGGATTTGGATAAATCTTATTNAATAGTCCTTTATTATCTGGCCAT ACCTTTTTCTCATCAGCATGTTGTATAAAATGCTTTCTATATGTTTNATGTTTTNCCTTTTTNATTTNCTTTTTGGTTAA TTTATCTATATAAGAATATCTCCTTCTTAAATATAATGGATCTATAAAACGATTTCGTATGGATAATGTTTTTNTNAAGC TTTCATTTTCATTNAATAAATNATAAAANCCATTTTCCGATTTTCCTATCNCTCCATTAGGCTNATAATCCTNNGGGTAT NGTCTTTCCCGAAACCTACCATTCAANTCCATTTGGCCAAGGTTAATAAAANGNGGGCCACCATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2959: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2959319293T027770119M3gmbPfHB3.1, G. Roman Reddy


Date: 16:27:50 on Fri 17 Nov 117.