EST 2960 is a singleton


Sequence

>2960 (1 EST) Length=334 TTATAATCATGTTACCTCTGTACCTCCTAATCAACACAGTGAACATAATAATAATAATTATTATCATAATAATAAGGAAA AAGATAACGNTAAAGATAAAGATAAAGATATATATGTTAAAGGATTGGCACACTTAAATCATATGANCAAATCCAAAAGG AATACGCACAGTTATATGTCTTCATATCATGAGGAATCTTTAAAAGATAGCGACGNCGCCGCATTATCCTCCTTCGGAAA TAAATCAAATGATTTAATAAAATCGAAACGNGGNGACATAGGCAANANTAANTATAATANTACTACCANANATAATCCTA GTNGTANTACTNAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2960: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2960319294T027780120M7gmbPfHB3.1, G. Roman Reddy


Date: 9:23:36 on Sun 19 Nov 117.