EST 2965 is a singleton


Sequence

>2965 (1 EST) Length=386 TTTATTTTATTTATTATATTTTTTTTTTTTTTTCCTTACCGAGCGGACGGGGCTTCAATATAAATNCTCTCAAATTATAA GGCCAGTTGGCTGGNTCATCAGAAGCCTTTTTTACTAATATATATATATCATTAGGAAAGTNCTGAACATAATTCCTAAC AATTTTCCTCGTTAATTCTGAACCTGCTTTAGAATCATCCTTAATTCCAGGCAAATCAACAAAAGTTGCATAGATACCAC CCGGTATAGAAATTCCGACTTCTAATTCTTTNAATATAATANGATTCATTTAAATTNANCATAATTGCTTTCATTTTTCC ATGTAAGGCATCTATAATTGCCCNTCCTTTTTNATTTAANTTAGGGATTCCANTNTTTNATTTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2965: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2965319299T027830129M3gmbPfHB3.1, G. Roman Reddy


Date: 0:47:27 on Fri 24 Nov 117.