EST 2966 is a singleton


Sequence

>2966 (1 EST) Length=421 TGATGGAGCATGGTAATGGGAGTGACAAGATATTCGACTTAAATTCTATAAGTCGAGAGAAGTTAGAGTTGGTTGAAGTA TTTTATGATAAGATGAAAGATACAACAAATGCAAATGCATTATATTTATATGCCTTACAAATATTTAAAATATGTAATAT ACATAATGAATTACCAAGNCTTGTTGTTTTTGGGCAACAATCTATGGGGAAAACAACTTTATTAGATTTTATTATGGGTG GTCCTATGGGATATACGAGTACTGATACAGGAACAAANCAACCCATCGTCATAATATTAAAACCTAGTGGTACTAATAAA CTTGGACTGCTATTTAACTAAANNGGANAGTAAAATATAGGTGCCTTCCATGGAAAAACNTGGANAGCNTTTATGGTTAA ATTTTAACCTGNCTCCTATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2966: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2966319300T027840129M7gmbPfHB3.1, G. Roman Reddy


Date: 8:52:27 on Mon 20 Nov 117.