EST 296600 is a singleton


Sequence

>296600 (1 EST) Length=142 ATCTTTGATAATAAATGCAAAAAAGGAAGAGGAAGAGGCTGAAGATTCTGTATCGATAACTGATGATCTAAAAGGAGCTG ATTATTATCATGGATTGATACCGCGTACCGATATTGAACCATTGCTAAAAAAAGAAGGCGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 296600: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296600905404H35921SWAMCA114SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 18:55:43 on Sat 18 Nov 117.